Anopheles mosquito Details Genus:Anopheles Species:gambiae Common Name:Anopheles mosquito Genbank Taxid: Group:Insect Habitat:freshwater Status:N/A Gene Region:CYTB Fragment Length:150 qPCR Chemistry:Probe Forward Primer:AGCTATACACTATGCCGCAGAT Reverse Primer:AAGCTCCGTTAGCGTGACAAA Probe:CGGCATAGTGTATAGCTAGGAATAAT PCR Efficiency:N/A R2: Limit of Detection:0.156 pg, Ct 39.65 Limit of Quantification:0.776 pg Journal: Source: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5981191/ Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast