Anopheles mosquito 0 comments Details Genus:Anopheles Species:gambiae Common Name:Anopheles mosquito Genbank Taxid: Group:Insect Habitat:freshwater Status:N/A Gene Region:CYTB Fragment Length:150 qPCR Chemistry:Probe Forward Primer:TCCTAGCTATACACTATGCCGC Reverse Primer:ATTTGTCACGCTAACGGAGCT Probe:CCCACCCTTTAATTAGAATCGCTAA PCR Efficiency:N/A R2: Limit of Detection:0.156 pg, Ct 39.65 Limit of Quantification:0.776 pg Journal:Wellcome Open Research Source: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5981191/ Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
