aquatic heteropteran Details Genus:Nepa Species:hoffmanni Common Name:aquatic heteropteran Genbank Taxid: Group:Arthropod Habitat:Freshwater Status:Endangered Gene Region:16S Fragment Length:117 qPCR Chemistry:Probe Forward Primer:ATAGGACGAGAAGACCCTGT Reverse Primer:ATAGGATCAATAAAACACTCATCCG Probe:TTGTTGGGGCGACAGGGAGA PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Royal Society Open Science Source: https://royalsocietypublishing.org/doi/10.1098/rsos.170568 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast