arctic char 0 comments Details Genus:Salvelinus Species:alpinus Common Name:arctic char Genbank Taxid: Group:Fish Habitat:Freshwater Status:Native Gene Region:CYTB Fragment Length:145 qPCR Chemistry:Probe Forward Primer:CCGCCACAGTACTTCACCTTCTA Reverse Primer:AGGCCAAGCAATATAGCTACGAAA Probe:FAM-CCGACAAAATCTCATTCC-MGB-NFQ PCR Efficiency:99.9 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Conservation Genetics Resources Source: https://doi.org/10.1007/s12686-017-0883-1 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.