Arctic grayling 0 comments Details Genus:Thymallus Species:arcticus Common Name:Arctic grayling Genbank Taxid: Group:Fish Habitat:Freshwater Status:Native Gene Region:COI Fragment Length:116 qPCR Chemistry:Probe Forward Primer:TGTGGGCTGTTCTGATTACCG Reverse Primer:TGCTGGGTCAAAGAAAGTGGTATTA Probe:CTTGCAGCAGGTATC PCR Efficiency:100.1 R2: Limit of Detection:5 copies per reaction Limit of Quantification:N/A Journal:Conservation Genetics Resources Source: https://link.springer.com/article/10.1007/s12686-017-0883-1 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
