arctic grayling 0 comments Details Genus:Thymallus Species:arcticus Common Name:arctic grayling Genbank Taxid: Group:Fish Habitat:Freshwater Status:Native Gene Region:COI Fragment Length:116 qPCR Chemistry:Probe Forward Primer:TGTGGGCTGTTCTGATTACCG Reverse Primer:TGCTGGGTCAAAGAAAGTGGTATTA Probe:FAM-CTTGCAGCAGGTATC-MGB-NFQ PCR Efficiency:1.001 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Conservation Genetics Resources Source: https://doi.org/10.1007/s12686-017-0883-1 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
