Arizona treefrog Details Genus:Hyla Species:wrightorum Common Name:Arizona treefrog Genbank Taxid: Group:Amphibian Habitat:freshwater Status:endangered/threatened Gene Region:N/A Fragment Length:105 qPCR Chemistry:Probe Forward Primer:CGCTCCATTCCAAATAAGCTAGGA Reverse Primer:AGGCGGTGGTTCGTTGGTTAG Probe:AGTCCTCGCCCTCCTCTTCTCCAT PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Science of the Total Environment Source: http://linkinghub.elsevier.com/retrieve/pii/S0048969718306958 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast