Asian bush mosquito 0 comments Details Genus:Aedes Species:japonicus japonicus Common Name:Asian bush mosquito Genbank Taxid: Group:Insect Habitat:Freshwater Status:Invasive Gene Region:COI Fragment Length:77+FP+RP qPCR Chemistry:Probe Forward Primer:GCTCCAGATATAGCTTTCCCTCG Reverse Primer:GGATAAACAGTTCATCCAGTTCCAG Probe:ACCTTACTACTTTCAAGTAGAATG PCR Efficiency:93.5 R2: Limit of Detection:11.94 fg/ul Limit of Quantification:34.23 fg/ul Journal:PLOS one Source: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5023106/ Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.