Asian clam 0 comments Details Genus:Corbicula Species:fluminea Common Name:Asian clam Genbank Taxid: Group:Mollusc Habitat:Freshwater Status:Invasive Gene Region:16S Fragment Length:165 qPCR Chemistry:Probe Forward Primer:GAATAACTTAAATGTAGGT Reverse Primer:AGCAAACTTCTTCTTAAATAT Probe:N/A PCR Efficiency:N/A R2: Limit of Detection:0.375 ng/ml Limit of Quantification:N/A Journal:PLoS ONE Source: https://doi.org/10.1371/journal.pone.0188126 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.