Atlantic cod 0 comments Details Genus:Gadus Species:morhua Common Name:Atlantic cod Genbank Taxid: Group:Fish Habitat:marine/brackish Status:native Gene Region:CYTB Fragment Length:80 qPCR Chemistry:Probe Forward Primer:TTCGCACCTAATTTACTCGGAG Reverse Primer:TCGGGCTTAACATGAGGTGG Probe:AGATAATTTCACCCCTGCTAACCCCATC PCR Efficiency:N/A R2: Limit of Detection:66 copies/L Limit of Quantification:667 copies/L Journal:Journal of Experimental Marine Biology and Ecology Source: https://www.sciencedirect.com/science/article/pii/S0022098118302168?via%3Dihub Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
