Atlantic Salmon Details Genus:Salmo Species:salar Common Name:Atlantic Salmon Genbank Taxid: Group:Fish Habitat:Marine/freshwater Status:fisheries Gene Region:COI Fragment Length:214 qPCR Chemistry:Probe Forward Primer:AGCAGAACTCAGCCAGCCT Reverse Primer:AAAGGAGGGAGGGAGAAGTCAA Probe:CCTTCTGGGAGATGACC PCR Efficiency:93.4 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Journal of Food Science Source: https://onlinelibrary.wiley.com/doi/full/10.1111/j.1750-3841.2010.01752.x Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast