Atlantic salmon 0 comments Details Genus:Salmo Species:salar Common Name:Atlantic salmon Genbank Taxid: Group:Fish Habitat:Freshwater Status:Invasive Gene Region:COI Fragment Length:74 qPCR Chemistry:Probe Forward Primer:CGCCCTAAGTCTCTTGATTCGA Reverse Primer:CGT TAT AAA TTT GGT CAT CTC CCA GACCTAAGTCTCTTGATTCGA Probe:(5’-AGA ACT CAG CCA GCC TG-3’)CCTAAGTCTCTTGATTCGA PCR Efficiency:100.018 R2: Limit of Detection:0.016 ng L-1 at Cq 34.5 Limit of Quantification:N/A Journal:bioRxiv Source: https://doi.org/10.1101/226829; Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.