bighead carp Details Genus:Hypophthalmichthys Species:nobilis Common Name:bighead carp Genbank Taxid: Group:Fish Habitat:freshwater/brackish Status:invasive Gene Region:D-loop Fragment Length:N/A qPCR Chemistry:Probe Forward Primer:GGTGGCGCAAAATGAACTAT Reverse Primer:GCAAGGTGAAAGGAAACCAA Probe:CCCCACATGCCGAGCATTCT PCR Efficiency:88.4% - 107.7% R2: Limit of Detection:20 copies per reaction Limit of Quantification:N/A Journal:Biological Conservation Source: https://doi.org/10.1016/j.biocon.2014.11.020 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast