black carp Details Genus:Mylopharyngodon Species:piceus Common Name:black carp Genbank Taxid: Group:Fish Habitat:Freshwater Status:Invasive Gene Region:COI Fragment Length:162 qPCR Chemistry:Probe Forward Primer:CCCACCACTCGCAGGCAATCTTGC Reverse Primer:GAGAGGTGTTTGGTATTGGGAAATGGCTGG Probe:CTGTAGATCTAACAATCTTTTCG PCR Efficiency:100.08 R2: Limit of Detection:1 target copy per reaction Limit of Quantification:N/A Journal:Journal of Great Lakes Research Source: https://www.sciencedirect.com/science/article/pii/S0380133017300874?casa_token=F8adBjQFZBMAAAAA:Jw_mIpSYaen1qUv6Zkc7-eJUy3Z_hInwX4SQKc4RLu43fJL8FPJ98aNgN-JkbCpB8W8O6MdU Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast