bluegill sunFish 0 comments Details Genus:Lepomis Species:macrochirus Common Name:bluegill sunFish Genbank Taxid: Group:Fish Habitat:freshwater Status:N/A Gene Region:CYTB Fragment Length:100 qPCR Chemistry:Probe Forward Primer:GCCTAGCAACCCAGATTTTAACA Reverse Primer:ACGTCCCGGCAGATGTGT Probe:CGACATCGCAACTGCCTTCTCTTCAGT PCR Efficiency:91–100% R2: Limit of Detection:N/A Limit of Quantification:30 copies per 2 μL per PCR Journal:PLoS ONE Source: https://doi.org/10.1371/journal.pone.0114639 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
