Details

Genus:

Lepomis

Species:

macrochirus

Common Name:

bluegill sunFish

Genbank Taxid:

Group:

Fish

Habitat:

freshwater

Status:

N/A

Gene Region:

CYTB

Fragment Length:

100

qPCR Chemistry:

Probe

Forward Primer:

GCCTAGCAACCCAGATTTTAACA

Reverse Primer:

ACGTCCCGGCAGATGTGT

Probe:

CGACATCGCAACTGCCTTCTCTTCAGT

PCR Efficiency:

91–100%

R2:

Limit of Detection:

N/A

Limit of Quantification:

30 copies per 2 ΞΌL per PCR

Journal:

PLoS ONE