Details

Genus:

Boa

Species:

constrictor

Common Name:

Boa constrictor

Genbank Taxid:

Group:

Reptile

Habitat:

freshwater

Status:

invasive

Gene Region:

CYTB

Fragment Length:

83

qPCR Chemistry:

Probe

Forward Primer:

CATGGTGAAACTTCGGATCAATAC

Reverse Primer:

TGTGTAATGTACGGCCAAGAAGA

Probe:

ATGCTCCATAATTCAAGTAC

PCR Efficiency:

90.68

R2:

Limit of Detection:

1 X 10āˆ’3 ng/Ī¼L

Limit of Quantification:

N/A

Journal:

PLOS One