Boa constrictor 0 comments Details Genus:Boa Species:constrictor Common Name:Boa constrictor Genbank Taxid: Group:Reptile Habitat:freshwater Status:invasive Gene Region:CYTB Fragment Length:83 qPCR Chemistry:Probe Forward Primer:CATGGTGAAACTTCGGATCAATAC Reverse Primer:TGTGTAATGTACGGCCAAGAAGA Probe:ATGCTCCATAATTCAAGTAC PCR Efficiency:90.68 R2: Limit of Detection:1 X 10−3 ng/μL Limit of Quantification:N/A Journal:PLOS One Source: http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0121655 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.