Boreal chorus frog Details Genus:Pseudacris Species:maculata Common Name:Boreal chorus frog Genbank Taxid: Group:Amphibian Habitat:Freshwater Status:Native Gene Region:COI Fragment Length:71 qPCR Chemistry:Probe Forward Primer:CTTGCTGGAAATTTAGCACACG Reverse Primer:ATAGCTCCTAGGATT GAAGACACACCGCACACG Probe:GGCCCATCAGTTGATGCACACG PCR Efficiency:94.9 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Conservation Genetics Resources Source: https://doi.org/10.1007/s12686-017-0962-3 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast