Details

Salvelinus fontinalis Brook trout

Genus:

Salvelinus

Species:

fontinalis

Common Name:

Brook trout

Genbank Taxid:

8038

Group:

Fish

Habitat:

Freshwater

Status:

Gene Region:

Cytb

Fragment Length:

qPCR Chemistry:

TaqMan

Forward Primer:

TGGCCAACCTCCGAAAAAC

Reverse Primer:

AGGTCGACTAGTGCGTCATTAGC

Probe:

CCCACTCCTAAAAAT

PCR Efficiency:

99.79

R2:

0.9967

Limit of Detection:

Limit of Quantification:

Journal:

Biological Invasions