Brook trout 0 comments Details Salvelinus fontinalis Brook trout Genus: Salvelinus Species: fontinalis Common Name: Brook trout Genbank Taxid: 8038 Group: Fish Habitat: Freshwater Status: Gene Region: Cytb Fragment Length: – qPCR Chemistry: TaqMan Forward Primer: TGGCCAACCTCCGAAAAAC Reverse Primer: AGGTCGACTAGTGCGTCATTAGC Probe: CCCACTCCTAAAAAT PCR Efficiency: 99.79 R2: 0.9967 Limit of Detection: – Limit of Quantification: – Journal: Biological Invasions Source: Schumer et al. 2019 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment Name * Email * Website Save my name, email, and website in this browser for the next time I comment.