Burmese python 0 comments Details Genus:Python Species:bivittatus Common Name:Burmese python Genbank Taxid: Group:Reptile Habitat: Status:invasive Gene Region:CYTB Fragment Length:<150 qPCR Chemistry:Conventional PCR Forward Primer:ACCATACAAGTATTAACCGG Reverse Primer:GTATGGAACATCGCGGG Probe:N/A PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Molecular Ecology Resources Source: https://doi.org/10.1111/1755-0998.12180 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.