Burmese Python 0 comments Details Genus:Python Species:molurus bivittatus Common Name:Burmese Python Genbank Taxid: Group:Reptile Habitat:Freshwater Status:Native Gene Region:ND4 Fragment Length:146 qPCR Chemistry:Probe Forward Primer:CACCCTAACAACTTCAATACCTCTACTAAT Reverse Primer:GAG GTT TGT TCA GTGGTT ATT TGT TTTCCTAACAACTTCAATACCTCTACTAAT Probe:CCA ACA CTA TTA TTCCTA GCA ACCCTAACAACTTCAATACCTCTACTAAT PCR Efficiency:1.0805 R2: Limit of Detection:8 X 10−6 ng/μL Limit of Quantification:N/A Journal:PLOS One Source: https://doi.org/10.1371/journal.pone.0121655 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
