Chilean devil ray, 0 comments Details Genus:Mobula Species:tarapacana Common Name:Chilean devil ray, Genbank Taxid: Group:Fish Habitat:Saltwater Status:Native Gene Region:COI Fragment Length:86 qPCR Chemistry:Dye Forward Primer:AACCACCTGCAATCTCTCAATATC Reverse Primer:GGGAAGAGATAATAATAGGACAGT Probe:CTTGTTTGTTTGATCAATTC PCR Efficiency:97 R2: Limit of Detection:0.25 pg/μL Limit of Quantification:N/A Journal:Mar Biol Source: https://doi.org/10.1007/s00227-017-3141-x Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
