Chiricahua leopard frog Details Genus:Rana Species:chiricahuensis Common Name:Chiricahua leopard frog Genbank Taxid: Group:Amphibian Habitat:freshwater Status:endangered/threatened Gene Region:N/A Fragment Length:84 qPCR Chemistry:Probe Forward Primer:GGTACCGCTCATATCATGACTACTTG Reverse Primer:TCCAGTTGGACTCACTTAGGAATG Probe:TAGGACCTTCGCTTGTTAT PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Science of the Total Environment Source: http://linkinghub.elsevier.com/retrieve/pii/S0048969718306958 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast