Chiricahua leopard frog 0 comments Details Genus:Rana Species:chiricahuensis Common Name:Chiricahua leopard frog Genbank Taxid: Group:Amphibian Habitat:Freshwater Status:Threatened Gene Region:N/A Fragment Length:84 qPCR Chemistry:Probe Forward Primer:GGTACCGCTCATATCATGACTACTTG Reverse Primer:TCCAGTTGGACTCACTTAGGAATG Probe:6FAM- TAGGACCTTCGCTTGTTAT-MGB PCR Efficiency:80-120% R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Elsevier Source: https://doi.org/10.1016/j.scitotenv.2018.02.295 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
