Coho salmon 0 comments Details Genus:Oncorhynchus Species:kisutch Common Name:Coho salmon Genbank Taxid: Group:Fish Habitat:marine/brackish/freshwater Status:native Gene Region:CYTB Fragment Length:114 qPCR Chemistry:Probe Forward Primer:CCTTGGTGGCGGATATACTTATCTTA Reverse Primer:GAACTAGGAAGATGGCGAAGTAGATC Probe:TGGAACACCCATTCAT PCR Efficiency:N/A R2: Limit of Detection:3.067x10-5 ng/μL Limit of Quantification:3.067e-004 ng/ μL Journal: Source: https://doi.org/10.3133/ofr20161091 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
