Coho Salmon 0 comments Details Genus:Oncorhynchus Species:kisutch Common Name:Coho Salmon Genbank Taxid: Group:Fish Habitat:freshwater/marine Status:Native Gene Region:CYTB Fragment Length:114 qPCR Chemistry:Probe Forward Primer:CCTTGGTGGCGGATATACTTATCTTA Reverse Primer:GAA CTAG GAA GAT GGC GAA GTA GAT CTGGTGGCGGATATACTTATCTTA Probe:TGG AAC ACC CAT TCA TTGGTGGCGGATATACTTATCTTA PCR Efficiency:97.06 R2: Limit of Detection:3.067 pg/15 mL Limit of Quantification:N/A Journal:North American Journal of Fisheries Management Source: https://afspubs.onlinelibrary.wiley.com/doi/full/10.1080/02755947.2017.1335255 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
