Details

Genus:

Cyprinus

Species:

carpio

Common Name:

common carp

Genbank Taxid:

Group:

Fish

Habitat:

freshwater/brackish

Status:

invasive

Gene Region:

12S

Fragment Length:

73

qPCR Chemistry:

Probe

Forward Primer:

CAAACTGGGATTAGATACCCCACTAT

Reverse Primer:

CTGGCGGACATCTAATTGTAGC

Probe:

CAGCCGTAAACTC

PCR Efficiency:

0.86ā€“0.99

R2:

Limit of Detection:

N/A

Limit of Quantification:

N/A

Journal:

Management of Biological Invasion