common carp 0 comments Details Genus:Cyprinus Species:carpio Common Name:common carp Genbank Taxid: Group:Fish Habitat:freshwater/brackish Status:invasive Gene Region:12S Fragment Length:73 qPCR Chemistry:Probe Forward Primer:CAAACTGGGATTAGATACCCCACTAT Reverse Primer:CTGGCGGACATCTAATTGTAGC Probe:CAGCCGTAAACTC PCR Efficiency:0.86–0.99 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Management of Biological Invasion Source: https://doi.org/10.3391/mbi.2017.8.1.09 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.