Common carp 0 comments Details Genus:Cyprinus Species:carpio Common Name:Common carp Genbank Taxid: Group:Fish Habitat:freshwater/brackish Status:N/A Gene Region:ITS1 Fragment Length:84 qPCR Chemistry:Probe Forward Primer:TTCAAAGACCCCCCGTAAC Reverse Primer:GCCATGCCGCACACA Probe:TCACGACCCCCCTTATTTTTTCCAAAACC PCR Efficiency:96.1 ± 12.5% R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Molecular Ecology Resources Source: https://onlinelibrary.wiley.com/doi/full/10.1111/1755-0998.12586 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.