common spadefoot toad Details Genus:Pelobates Species:fuscus Common Name:common spadefoot toad Genbank Taxid: Group:Amphibian Habitat:Freshwater Status:Thretened/Endangered Gene Region:CYTB Fragment Length:72 qPCR Chemistry:Probe Forward Primer:GGCTTTTTCCATCGCAATTCT Reverse Primer:CGAAATATCATGCTCCGTTGTTT Probe:CCCTTATGCCCATTCTTCACACCGC PCR Efficiency:80-100 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Molecular Ecology Source: https://onlinelibrary-wiley-com.proxy.lib.umich.edu/doi/full/10.1111/j.1365-294X.2011.05418.x Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast