crocodile lizard 0 comments Details Genus:Shinisaurus Species:crocodilurus Common Name:crocodile lizard Genbank Taxid: Group:Reptile Habitat:Freshwater Status:Thretened/Endangered Gene Region:CYTB Fragment Length:97 qPCR Chemistry:Dye Forward Primer:GCCCACATCTGCCGAGAT Reverse Primer:CGATATGAAGGTAAATGCAGAAGAAA Probe:N/A PCR Efficiency:92.12 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Aquatic Conservation: Marine and Freshwater Ecosystems Source: https://onlinelibrary.wiley.com/doi/full/10.1002/aqc.3038 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
