Crown of Thorns Seastar 0 comments Details Genus:Acanthaster Species:cf. Common Name:Crown of Thorns Seastar Genbank Taxid: Group:other Habitat:Marine Status:N/A Gene Region:COI Fragment Length:126 qPCR Chemistry:Probe Forward Primer:TCCGACTACCCGGACGCCTATAC Reverse Primer:AGTGGTTCGCTGGGAAGTGAAGG Probe:CTATCTCATCCATAGGCAGCAC PCR Efficiency:99 R2: Limit of Detection:N/A Limit of Quantification:225 copies per reaction Journal:Coral Reefs Source: https://link.springer.com/article/10.1007/s00338-018-1734-6 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
