Crucian carp 0 comments Details Genus:Carassius Species:carassius Common Name:Crucian carp Genbank Taxid: Group:Fish Habitat:freshwater Status:native Gene Region:CYTB Fragment Length:118 qPCR Chemistry:Probe Forward Primer:AGTTGCAGATATGGCTATCTTAA Reverse Primer:TGGAAAGAGGACAAGGAATAAT Probe:ATGGATTGGAGGCATACCAGTAGAACACC PCR Efficiency:93.61% (79.61%–102.49%) R2: Limit of Detection:1 copy/μl Limit of Quantification:10 copies/μl Journal:Freshwater Biology Source: https://onlinelibrary.wiley.com/doi/full/10.1111/fwb.13197 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
