Deepwater sculpin 0 comments Details Genus:Myoxocephalus Species:thompsonii Common Name:Deepwater sculpin Genbank Taxid: Group:Fish Habitat:freshwater Status:Fishery Gene Region:COI Fragment Length:148 qPCR Chemistry:Probe Forward Primer:CTTAGCCTCTTCGGGGGTTG Reverse Primer:TGCTCCGAGGATCGAAGAGA Probe:CCACGCGGGAGCCTCTGTTG PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:PLOS One Source: https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0210165 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.