Dolly Varden Details Genus:Salvelinus Species:malma Common Name:Dolly Varden Genbank Taxid: Group:Fish Habitat:marine/brackish/freshwater Status:endangered/threatened Gene Region:CYTB Fragment Length:139 qPCR Chemistry:Probe Forward Primer:CTTATTTGCCTACGCAATTCTCC Reverse Primer:GTGAGGATGAGTATGTCTGCTACCA Probe:TTGTCCCGATCCTCCACA PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:The Ecological Society of Japan Source: https://esj-journals.onlinelibrary.wiley.com/doi/full/10.1111/1440-1703.1018 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast