European plaice Details Genus:Pleuronectes Species:platessa Common Name:European plaice Genbank Taxid: Group:Fish Habitat:marine/brackish Status:native Gene Region:CYTB Fragment Length:90 qPCR Chemistry:Probe Forward Primer:TAGGCTTCGCAGTCCTCCTC Reverse Primer:TTGCAGGCGTGAAGTTGTCT Probe:CTAAAAGATTTGGGGAAAATAGGGCGAGT PCR Efficiency:N/A R2: Limit of Detection:66 copies/L Limit of Quantification:667 copies/L Journal:Journal of Experimental Marine Biology and Ecology Source: https://www.sciencedirect.com/science/article/pii/S0022098118302168?via%3Dihub Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast