European pond turtle Details Genus:Emys Species:orbicularis Common Name:European pond turtle Genbank Taxid: Group:Reptile Habitat:Freshwater Status:Thretened/Endangered Gene Region:CYTB Fragment Length:115 qPCR Chemistry:Dye Forward Primer:CCAAATATCCTTCTGAGGTGC Reverse Primer:GCGTTATCTACTGAGAATCC Probe:N/A PCR Efficiency:N/A R2: Limit of Detection:5 × 10^(−11) μg/μl Limit of Quantification:N/A Journal:Amphibia-Reptilia Source: https://doi.org/10.1163/15685381-17000025 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast