fatmucket clam Details Genus:Lampsilis Species:siliquoidea Common Name:fatmucket clam Genbank Taxid: Group:Mollusc Habitat:Freshwater Status:Native Gene Region:ND1 Fragment Length:147 qPCR Chemistry:Dye Forward Primer:TCGAGCCATAGCTCAAACCA Reverse Primer:GCG AGT GGT AGT GAA AGA GTAGCCATAGCTCAAACCA Probe:AGCCATAGCTCAAACCA PCR Efficiency:99 R2: Limit of Detection:N/A Limit of Quantification:1 copy of the gene target/mL Journal:Environmental Science and Technology Source: https://pubs.acs.org/doi/10.1021/acs.est.7b05199 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast
