Florida manatee 0 comments Details Genus:Trichechus Species:manatus latirostris Common Name:Florida manatee Genbank Taxid: Group:Mammal Habitat:Saltwater Status:Vulnerable Gene Region:CYTB Fragment Length:69 qPCR Chemistry:Probe Forward Primer:CGCTAACCGCATTCTCTTCAG Reverse Primer:GGT AGC GAA TGA TYCAAC CAT AGT TTAACCGCATTCTCTTCAG Probe:(5’-CCC ACA TTT GCC GAGAC-3’)TAACCGCATTCTCTTCAG PCR Efficiency:90-110% R2: Limit of Detection:copy number of 13 molecules μl−1 Limit of Quantification:N/A Journal:Endangered Species Research Source: https://doi.org/10.3354/esr00880 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.