Freshwater pearl mussel 0 comments Details Genus:Margaritifera Species:margaritifera L. Common Name:Freshwater pearl mussel Genbank Taxid: Group:Mollusc Habitat:Freshwater Status:Endangered Gene Region:COI Fragment Length:83 qPCR Chemistry:Probe Forward Primer:TTGTTGATTCGTGCTGAGTTAGG Reverse Primer:GCA TGA GCC GTA ACA ATA ACA TTGTTGATTCGTGCTGAGTTAGG Probe:(5′‐ CCT GGT TCT TTG CTGGGT‐3′)TTGATTCGTGCTGAGTTAGG PCR Efficiency:96.62 R2: Limit of Detection:0.122 pg L−1 Limit of Quantification:N/A Journal:Wiley Source: https://onlinelibrary.wiley.com/resolve/doi?DOI=10.1002/aqc.2788 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
