golden mussels Details Genus:Limnoperna Species:fortunei Common Name:golden mussels Genbank Taxid: Group:Mollusc Habitat:Freshwater Status:Invasive Gene Region:COI Fragment Length:197 qPCR Chemistry:Dye Forward Primer:AGAACCCCAGCAGTTGACATAG Reverse Primer:CCACCTAGAACTGGTAGTGAAACTAAC Probe:N/A PCR Efficiency:98 R2: Limit of Detection:1 × 10^(−7) ng/μl Limit of Quantification:1.0 × 10^(−4) ng/μl Journal:Ecology and Evolution Source: https://onlinelibrary.wiley.com/doi/full/10.1002/ece3.4636 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast