Golden Tree Frog Details Genus:Phytotriades Species:auratus Common Name:Golden Tree Frog Genbank Taxid: Group:Amphibian Habitat:Freshwater Status:Thretened/Endangered Gene Region:CYTB Fragment Length:80 qPCR Chemistry:Probe Forward Primer:GCGGATTCTCTGTCGACAATG Reverse Primer:TGCTCCTGCAATAAGAAATGGA Probe:CTCTCACCCGATTTTTTACAT PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:PLOS ONE Source: https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0168787 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast