GoldFish 0 comments Details Genus:Carassius Species:auratus Common Name:GoldFish Genbank Taxid: Group:Fish Habitat:freshwater/brackish Status:invasive Gene Region:CYTB Fragment Length:N/A qPCR Chemistry:Probe Forward Primer:GACCTCCTTGGGTTCGTGATT Reverse Primer:TCTGGGTCTCCTAAAAGGTTTGG Probe:CCCTCACACTCCTGG PCR Efficiency:95 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Freshwater Science Source: https://www.journals.uchicago.edu/doi/10.1086/699203 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
