Grass carp 0 comments Details Genus:Ctenopharygodon Species:idella Common Name:Grass carp Genbank Taxid: Group:Fish Habitat:Freshwater Status:Native Gene Region:COI Fragment Length:151 qPCR Chemistry:Dye Forward Primer:AGTTTACCCACCACTCGCAG Reverse Primer:GGAGATGGCTGGTGGTTTCA Probe:N/A PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Conservation Genetics Resources Source: https://doi.org/10.1007/s12686-013-9946-0 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.