Grass Carp Details Genus:Ctenopharyngodon Species:idella Common Name:Grass Carp Genbank Taxid: Group:Fish Habitat:Freshwater Status:Invasive Gene Region:CYTB Fragment Length:61 qPCR Chemistry:Probe Forward Primer:CAACGACGCGCTAGTCGA Reverse Primer:TCC AAA GTT TCA TCA TGC AGA GACGACGCGCTAGTCGA Probe:TTCCCACACCATCTAACGACGCGCTAGTCGA PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Molecular Ecology Resources Source: https://doi.org/10.1111/1755-0998.12619 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast