Hay’s spring amphipod 0 comments Details Genus:Stygobromus Species:hayi Common Name:Hay’s spring amphipod Genbank Taxid: Group:Crustacean Habitat:freshwater Status:endangered/threatened Gene Region:COI Fragment Length:126 qPCR Chemistry:Probe Forward Primer:GCATCTGTCGACTTAGCTATT Reverse Primer:CGGCACTTGGTCTATAGTTATT Probe:TCACTTCATTTAGCAGGAGCCTCCTC PCR Efficiency:N/A R2: Limit of Detection:6.2×10−4 ng/μL Limit of Quantification:N/A Journal:Conservation Genetics Resources Source: https://doi.org/10.1007/s12686-017-0785-2 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
