Hula Painted Frog 0 comments Details Genus:Latonia Species:nigriventer Common Name:Hula Painted Frog Genbank Taxid: Group:Amphibian Habitat:Freshwater Status:Thretened/Endangered Gene Region:12S Fragment Length:110 qPCR Chemistry:Probe Forward Primer:GAACTACGAGCCTCAGCTTAAA Reverse Primer:GGC AAG AAG TGG TGA GGT TACTACGAGCCTCAGCTTAAA Probe:CAA ACC CAC CTA GAG GAG CCT GTTCTACGAGCCTCAGCTTAAA PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Molecular Ecology Source: https://onlinelibrary-wiley-com.proxy.lib.umich.edu/doi/full/10.1111/mec.14420 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
