Japanese clawed salamander 0 comments Details Genus:Onychodactylus Species:japonicus Common Name:Japanese clawed salamander Genbank Taxid: Group:Amphibian Habitat:freshwater Status:endangered/threatened Gene Region:12S Fragment Length:123 qPCR Chemistry:Probe Forward Primer:TACTTGAAACCACGACCGCT Reverse Primer:CGCCAAGTCCTTTGAGTTTT Probe:TCCGCCAGATTACTACGAGC PCR Efficiency:78.45 to 95.65%. R2: Limit of Detection:1 copy/reaction Limit of Quantification:N/A Journal:PLoS ONE Source: https://doi.org/10.1371/journal.pone.0176541 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
