Details

Anguilla japonica Japanese eel

Genus:

Anguilla

Species:

japonica

Common Name:

Japanese eel

Genbank Taxid:

7937

Group:

Fish

Habitat:

Catadromous

Status:

Gene Region:

16S

Fragment Length:

154

qPCR Chemistry:

2 × Master Mix

Forward Primer:

AATCAGTAATAAGAGGGCCCAAGC

Reverse Primer:

TGTTGGGTTAACGGTTTGTGGTA

Probe:

CACATGTGTAAGTCAGAACGGACCGACC

PCR Efficiency:

82.4 to 88.9

R2:

0.9975 to 1

Limit of Detection:

0.2 copy / reaction

Limit of Quantification:

Journal:

Scientific Reports