largemouth bass 0 comments Details Genus:Micropterus Species:salmoides Common Name:largemouth bass Genbank Taxid: Group:Fish Habitat:Freshwater Status:Native Gene Region:CYTB Fragment Length:N/A qPCR Chemistry:Probe Forward Primer:GCCCACATTTGTCGTGATGTAA Reverse Primer:AGCCCCGGCCGATATG Probe:CTAACGGTGCATCCTTCTTTTTCATCTGCA PCR Efficiency:82.379 to 91.462 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Ecological Research Source: https://link-springer-com.proxy.lib.umich.edu/article/10.1007/s11284-016-1400-9 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.