Longfin Smelt 0 comments Details Genus:Spirinchus Species:thaleichthys Common Name:Longfin Smelt Genbank Taxid: Group:Fish Habitat:Brackish Status:Threatened Gene Region:CYTB Fragment Length:<150 qPCR Chemistry:Probe Forward Primer:CTCTGCCGGGACGTCAAT Reverse Primer:CCCGTTAGCGTGCATATTCC Probe:Probe-ACGGCTGACTAATC PCR Efficiency:94.2 R2: Limit of Detection:0.64 pg/μL Limit of Quantification:N/A Journal:Molecular Ecology Resources Source: https://doi.org/10.1111/1755-0998.12305 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.